Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #162444)


Item Catalog # Description Quantity Price (USD)
Plasmid 162444 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    C-C chemokine receptor type 5
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    All L, I, V, F in the transmembrane region mutated to Q, T and Y, truncation from aa123 to aa256
  • GenBank ID
  • Entrez Gene
    CCR5 (a.k.a. CC-CKR-5, CCCKR5, CCR-5, CD195, CKR-5, CKR5, CMKBR5, IDDM22)
  • Tag / Fusion Protein
    • his-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer aagcccgaaaggaagctgagtt
  • 3′ sequencing primer aactcagcttcctttcgggctt
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CCR5-SZ218a QTY was a gift from Shuguang Zhang (Addgene plasmid # 162444 ; ; RRID:Addgene_162444)
  • For your References section:

    Non-full-length Water-Soluble CXCR4(QTY) and CCR5(QTY) Chemokine Receptors: Implication for Overlooked Truncated but Functional Membrane Receptors. Qing R, Tao F, Chatterjee P, Yang G, Han Q, Chung H, Ni J, Suter BP, Kubicek J, Maertens B, Schubert T, Blackburn C, Zhang S. iScience. 2020 Oct 28;23(12):101670. doi: 10.1016/j.isci.2020.101670. eCollection 2020 Dec 18. 10.1016/j.isci.2020.101670 PubMed 33376963