pL0-BvCYP76AD1
(Plasmid
#162529)
-
PurposeBeta vulgaris cytochrome P450 76AD1 coding sequence in pICH41308 MoClo Golden Gate level 0 acceptor for CDS1 modules.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162529 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepICH41308
-
Backbone manufacturer47998 (Sylvestre Marillonnet)
- Backbone size w/o insert (bp) 2248
- Total vector size (bp) 2742
-
Vector typeBacterial Expression ; pUC19-derived
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCYP76AD1
-
Alt namecytochrome P450 76AD1
-
SpeciesBeta vulgaris
-
Insert Size (bp)1494
-
GenBank IDMH836617
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer MoClo_lv0_F0015: CGTTATCCCCTGATTCTGTGGATAAC
- 3′ sequencing primer MoClo_lv0_R0016: GTCTCATGAGCGGATACATATTTGAATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pL0-BvCYP76AD1 was a gift from Sam Brockington (Addgene plasmid # 162529 ; http://n2t.net/addgene:162529 ; RRID:Addgene_162529) -
For your References section:
MycoRed: Betalain pigments enable in vivo real-time visualisation of arbuscular mycorrhizal colonisation. Timoneda A, Yunusov T, Quan C, Gavrin A, Brockington SF, Schornack S. PLoS Biol. 2021 Jul 14;19(7):e3001326. doi: 10.1371/journal.pbio.3001326. 10.1371/journal.pbio.3001326 PubMed 34260583