Skip to main content
Addgene

px330-Alb-2
(Plasmid #162545)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162545 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    px330
  • Backbone manufacturer
    Feng Zhang lab (Addgene plasmid # 42230)
  • Backbone size w/o insert (bp) 8500
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA targeting Alb
  • gRNA/shRNA sequence
    GGGTACTCACTGTCCCATAA
  • Species
    M. musculus (mouse)
  • Mutation
    None
  • Entrez Gene
    Alb (a.k.a. Alb-1, Alb1, BCL001, BCL002, BPL001)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer hU6-F
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px330-Alb-2 was a gift from Amaia Lujambio (Addgene plasmid # 162545 ; http://n2t.net/addgene:162545 ; RRID:Addgene_162545)
  • For your References section:

    Cooperation between distinct cancer driver genes underlies inter-tumor heterogeneity in hepatocellular carcinoma. Molina-Sanchez P, Ruiz de Galarreta M, Yao MA, Lindblad KE, Bresnahan E, Bitterman E, Martin TC, Rubenstein T, Nie K, Golas J, Choudhary S, Barcena-Varela M, Elmas A, Miguela V, Ding Y, Kan Z, Grinspan LT, Huang KL, Parsons RE, Shields DJ, Rollins RA, Lujambio A. Gastroenterology. 2020 Aug 16. pii: S0016-5085(20)35054-X. doi: 10.1053/j.gastro.2020.08.015. 10.1053/j.gastro.2020.08.015 PubMed 32814112