pcDNA4/TO-2xStrep-ORF68 K174A/R179A/K182A
(Plasmid
#162639)
-
PurposeExpresses N-terminal 2x-Strep-tagged ORF68 K174A/R179A/K182A in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162639 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA4/TO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5111
- Total vector size (bp) 6512
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameORF68
-
SpeciesKSHV (HHV-8)
-
Insert Size (bp)1401
-
MutationAmino acids K174, R179, and K182 mutated to alanine
- Promoter CMV
-
Tag
/ Fusion Protein
- N-terminal 2xStrep-Tag II (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer ACAGTGGGAGTGGCACCTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA4/TO-2xStrep-ORF68 K174A/R179A/K182A was a gift from Britt Glaunsinger (Addgene plasmid # 162639 ; http://n2t.net/addgene:162639 ; RRID:Addgene_162639) -
For your References section:
A pentameric protein ring with novel architecture is required for herpesviral packaging. Didychuk AL, Gates SN, Gardner MR, Strong LM, Martin A, Glaunsinger BA. Elife. 2021 Feb 8;10. pii: 62261. doi: 10.7554/eLife.62261. 10.7554/eLife.62261 PubMed 33554858