pFE-Selo-FI-prk
(Plasmid
#162698)
-
PurposeExpresses S. elongatus Form IB rubisco and S. elongatus Prk
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Berkeley
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162698 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepFE21 (derived from pZE21 expressing under PLtet0-1 and constitutive tetR)
- Backbone size w/o insert (bp) 3127
- Total vector size (bp) 6043
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameS. elongatus Form IB rubisco and S. elongatus Prk
-
SpeciesS. elongatus
-
Insert Size (bp)2916
- Promoter PLtet0-1 promoter
-
Tag
/ Fusion Protein
- N terminal 6x His tag on PRK (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gaaagccatccagtttactttgca
- 3′ sequencing primer GCGTTCACCGACAAACAACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid expresses the large/small subunits of S. elongatus Form IB rubisco and S. elongatus Prk
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFE-Selo-FI-prk was a gift from David Savage (Addgene plasmid # 162698 ; http://n2t.net/addgene:162698 ; RRID:Addgene_162698) -
For your References section:
Functional reconstitution of a bacterial CO2 concentrating mechanism in E. coli. Flamholz AI, Dugan E, Blikstad C, Gleizer S, Ben-Nissan R, Amram S, Antonovsky N, Ravishankar S, Noor E, Bar-Even A, Milo R, Savage D. Elife. 2020 Oct 21;9. pii: 59882. doi: 10.7554/eLife.59882. 10.7554/eLife.59882 PubMed 33084575