Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFE-Selo-FI-prk
(Plasmid #162698)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 162698 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFE21 (derived from pZE21 expressing under PLtet0-1 and constitutive tetR)
  • Backbone size w/o insert (bp) 3127
  • Total vector size (bp) 6043
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    S. elongatus Form IB rubisco and S. elongatus Prk
  • Species
    S. elongatus
  • Insert Size (bp)
    2916
  • Promoter PLtet0-1 promoter
  • Tag / Fusion Protein
    • N terminal 6x His tag on PRK (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gaaagccatccagtttactttgca
  • 3′ sequencing primer GCGTTCACCGACAAACAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid expresses the large/small subunits of S. elongatus Form IB rubisco and S. elongatus Prk

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFE-Selo-FI-prk was a gift from David Savage (Addgene plasmid # 162698 ; http://n2t.net/addgene:162698 ; RRID:Addgene_162698)
  • For your References section:

    Functional reconstitution of a bacterial CO2 concentrating mechanism in E. coli. Flamholz AI, Dugan E, Blikstad C, Gleizer S, Ben-Nissan R, Amram S, Antonovsky N, Ravishankar S, Noor E, Bar-Even A, Milo R, Savage D. Elife. 2020 Oct 21;9. pii: 59882. doi: 10.7554/eLife.59882. 10.7554/eLife.59882 PubMed 33084575