pCB’ CsoS2 ΔNTD
(Plasmid
#162705)
-
PurposeCarboxysome operon with truncated CsoS2 (deletion of amino acids 2-256), prk; Deletion of rubisco-binding N-terminus of CsoS2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162705 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFE21 (derived from pZE21 under PLtet0-1 and constitutive tetR)
- Backbone size w/o insert (bp) 3127
- Total vector size (bp) 12000
-
Modifications to backbonepCB reconstructed after selection for CCMB1 growth on glycerol under ambient air
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepHnCB10 derived carboxysome operon, prk
-
SpeciesH. neapolitanus and S. elongatus
-
Insert Size (bp)9490
-
MutationDeletion of residues 2-256 of CsoS2, Y131D
- Promoter PLtet0-1 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gaaagccatccagtttactttgca
- 3′ sequencing primer GCGTTCACCGACAAACAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Deletion of rubisco-binding N-terminus of CsoS2 prevents carboxysome formation.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCB’ CsoS2 ΔNTD was a gift from David Savage (Addgene plasmid # 162705 ; http://n2t.net/addgene:162705 ; RRID:Addgene_162705) -
For your References section:
Functional reconstitution of a bacterial CO2 concentrating mechanism in E. coli. Flamholz AI, Dugan E, Blikstad C, Gleizer S, Ben-Nissan R, Amram S, Antonovsky N, Ravishankar S, Noor E, Bar-Even A, Milo R, Savage D. Elife. 2020 Oct 21;9. pii: 59882. doi: 10.7554/eLife.59882. 10.7554/eLife.59882 PubMed 33084575