Skip to main content

pBL-2
(Plasmid #162769)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162769 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC18
  • Modifications to backbone
    The pBL-2 plasmid was obtained by two stages of inverted PCR using long adapter primers and the pUC18 plasmid as a template. Non-functional parts of the plasmid including the pLac promoter and the LacZ gene were removed.
  • Vector type
    Synthetic Biology ; molecular cloning
  • Promoter no

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer SQ-BlaN-F TAAGGGCGACACGGAAATG
  • 3′ sequencing primer SQprimer CGCTTCCTCGCTCACTGACT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBL-2 was a gift from Ivan Vorobiev (Addgene plasmid # 162769 ; http://n2t.net/addgene:162769 ; RRID:Addgene_162769)
  • For your References section:

    Improved elongation factor-1 alpha-based vectors for stable high-level expression of heterologous proteins in Chinese hamster ovary cells. Orlova NA, Kovnir SV, Hodak JA, Vorobiev II, Gabibov AG, Skryabin KG. BMC Biotechnol. 2014 Jun 14;14:56. doi: 10.1186/1472-6750-14-56. 10.1186/1472-6750-14-56 PubMed 24929670