pBL-2
(Plasmid
#162769)
-
Purpose(Empty Backbone) Minimal backbone with AmpR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162769 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC18
-
Modifications to backboneThe pBL-2 plasmid was obtained by two stages of inverted PCR using long adapter primers and the pUC18 plasmid as a template. Non-functional parts of the plasmid including the pLac promoter and the LacZ gene were removed.
-
Vector typeSynthetic Biology ; molecular cloning
- Promoter no
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer SQ-BlaN-F TAAGGGCGACACGGAAATG
- 3′ sequencing primer SQprimer CGCTTCCTCGCTCACTGACT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBL-2 was a gift from Ivan Vorobiev (Addgene plasmid # 162769 ; http://n2t.net/addgene:162769 ; RRID:Addgene_162769) -
For your References section:
Improved elongation factor-1 alpha-based vectors for stable high-level expression of heterologous proteins in Chinese hamster ovary cells. Orlova NA, Kovnir SV, Hodak JA, Vorobiev II, Gabibov AG, Skryabin KG. BMC Biotechnol. 2014 Jun 14;14:56. doi: 10.1186/1472-6750-14-56. 10.1186/1472-6750-14-56 PubMed 24929670