pFBP-2_6.sensor
(Plasmid
#162800)
-
PurposeYeast expression of the RNA-based sensor for fructose-1,6-bisphosphate #2_6
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162800 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCS1748
-
Backbone manufacturerhttps://doi.org/10.1093/nar/gks636
- Backbone size w/o insert (bp) 8187
- Total vector size (bp) 8305
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name2_6_RNA-device
-
SpeciesSynthetic; Tobacco ringspot virus
-
Insert Size (bp)123
-
GenBank ID2_6_RNA-device
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer -
- 3′ sequencing primer CAGGAAACAGCTATGACCATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFBP-2_6.sensor was a gift from Matthias Heinemann (Addgene plasmid # 162800 ; http://n2t.net/addgene:162800 ; RRID:Addgene_162800) -
For your References section:
A synthetic RNA-based biosensor for fructose-1,6-bisphosphate that reports glycolytic flux. Ortega AD, Takhaveev V, Vedelaar SR, Long Y, Mestre-Farras N, Incarnato D, Ersoy F, Olsen LF, Mayer G, Heinemann M. Cell Chem Biol. 2021 Apr 22. pii: S2451-9456(21)00161-6. doi: 10.1016/j.chembiol.2021.04.006. 10.1016/j.chembiol.2021.04.006 PubMed 33915105