Skip to main content

pPodA11
(Plasmid #162843)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162843 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTEV16
  • Backbone size w/o insert (bp) 5334
  • Total vector size (bp) 5838
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Protein Designed Pyocyanin demethylase
  • Alt name
    PodA10
  • Species
    Mycolicibacterium fortuitum subsp. fortuitum DSM 46621 = ATCC 6841
  • Insert Size (bp)
    369
  • Mutation
    A53N, I73T, A87V, M99V, A129T from WT PodA
  • GenBank ID
    MFORT_14352
  • Promoter T7
  • Tag / Fusion Protein
    • TEV-cleavable 6x-His tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspQI (destroyed during cloning)
  • 3′ cloning site BspQI (destroyed during cloning)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPodA11 was a gift from Dianne Newman (Addgene plasmid # 162843 ; http://n2t.net/addgene:162843 ; RRID:Addgene_162843)
  • For your References section:

    Computationally designed pyocyanin demethylase acts synergistically with tobramycin to kill recalcitrant Pseudomonas aeruginosa biofilms. VanDrisse CM, Lipsh-Sokolik R, Khersonsky O, Fleishman SJ, Newman DK. Proc Natl Acad Sci U S A. 2021 Mar 23;118(12). pii: 2022012118. doi: 10.1073/pnas.2022012118. 10.1073/pnas.2022012118 PubMed 33723058