Skip to main content

pmEos2-N1 GBP (GBP-mEos2)
(Plasmid #162876)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162876 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmEos2-N1
  • Backbone manufacturer
    EGFP replaced with mEos2 in pEGFP-N1 backbone (Clontec)
  • Backbone size w/o insert (bp) 3973
  • Total vector size (bp) 5021
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP Binding Protein tagged with mEos2
  • Alt name
    GBP, GFP Nanobody, abGFP4
  • Insert Size (bp)
    1048
  • Tag / Fusion Protein
    • mEos2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (CMV F)
  • 3′ sequencing primer TGTACCATCTCCGTCGATCA (mEos2 R)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    GBP insert was derived from pOPINE GFP nanobody (Plasmid #49172)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmEos2-N1 GBP (GBP-mEos2) was a gift from Frederic Meunier (Addgene plasmid # 162876 ; http://n2t.net/addgene:162876 ; RRID:Addgene_162876)
  • For your References section:

    Modular transient nanoclustering of activated beta2-adrenergic receptors revealed by single-molecule tracking of conformation-specific nanobodies. Gormal RS, Padmanabhan P, Kasula R, Bademosi AT, Coakley S, Giacomotto J, Blum A, Joensuu M, Wallis TP, Lo HP, Budnar S, Rae J, Ferguson C, Bastiani M, Thomas WG, Pardon E, Steyaert J, Yap AS, Goodhill GJ, Hilliard MA, Parton RG, Meunier FA. Proc Natl Acad Sci U S A. 2020 Nov 19. pii: 2007443117. doi: 10.1073/pnas.2007443117. 10.1073/pnas.2007443117 PubMed 33214152