pmCherry-N1 GBP (GBP-mCherry)
(Plasmid #162879)

• Purpose: Expression in mammalian cells of GFP binding protein (GBP) tagged with mCherry
• Depositing Lab: Frederic Meunier
• Publication: Gormal et al Proc Natl Acad Sci U S A. 2020 Nov 19. pii: 2007443117. doi: 10.1073/pnas.2007443117.

Backbone

• Vector backbone: pmCherry-N1
• Backbone manufacturer: Clontec
• Total vector size (bp): 5043
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP Binding Protein
• Alt name: GBP, GFP Nanobody, abGFP4
• Insert Size (bp): 1078
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG (CMV F)
• 3′ sequencing primer: TTGGTCACCTTCAGCTTGG (mCherry R)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GBP insert was derived from pOPINE GFP nanobody (Plasmid #49172)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry