Skip to main content

pAT9750-BEAR-mCherry
(Plasmid #162990)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162990 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry split with an intron between amino acids 119-120
  • Species
    Synthetic; disrupted 5' splice site
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAACGGGACTTTCCAAAATG
  • 3′ sequencing primer GGTTCAGGGGGAGGTGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAT9750-BEAR-mCherry was a gift from Ervin Welker (Addgene plasmid # 162990 ; http://n2t.net/addgene:162990 ; RRID:Addgene_162990)
  • For your References section:

    BEAR reveals that increased fidelity variants can successfully reduce the mismatch tolerance of adenine but not cytosine base editors. Talas A, Simon DA, Kulcsar PI, Varga E, Krausz SL, Welker E. Nat Commun. 2021 Nov 3;12(1):6353. doi: 10.1038/s41467-021-26461-y. 10.1038/s41467-021-26461-y PubMed 34732717