Skip to main content

pHis-Hgd
(Plasmid #163091)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163091 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHis parallel
  • Backbone manufacturer
    invitrogen
  • Backbone size w/o insert (bp) 5554
  • Total vector size (bp) 6992
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Hgd
  • Alt name
    pHis-Hgd
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1338
  • Entrez Gene
    Hgd (a.k.a. Hgo, aku)
  • Promoter T7
  • Tag / Fusion Protein
    • his (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer gttagcagccggatctcag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHis-Hgd was a gift from Joseph Takahashi (Addgene plasmid # 163091 ; http://n2t.net/addgene:163091 ; RRID:Addgene_163091)
  • For your References section:

    Tissue-specific FAH deficiency alters sleep-wake patterns and results in chronic tyrosinemia in mice. Yang S, Siepka SM, Cox KH, Kumar V, de Groot M, Chelliah Y, Chen J, Tu B, Takahashi JS. Proc Natl Acad Sci U S A. 2019 Oct 29;116(44):22229-22236. doi: 10.1073/pnas.1904485116. Epub 2019 Oct 14. 10.1073/pnas.1904485116 PubMed 31611405