pBAD_IPF2.0
(Plasmid #163124)

• Purpose: A plasmid with IFP2.0 coding sequence coded into it. Expresses IFP2.0 with N-term His-tag.
• Depositing Lab: Julie Biteen
• Publication: Chia et al Curr Res Microb Sci. 2020 Sep;1:1-6. doi: 10.1016/j.crmicr.2020.04.001. Epub 2020 May 11.

Backbone

• Vector backbone: pBAD
• Backbone size w/o insert (bp): 5441
• Total vector size (bp): 6140
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: IFP2.0
• Species: Deinococcus radiodurans
• Insert Size (bp): 966
• Tag / Fusion Protein:
  • His (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC

Resource Information

• Supplemental Documents:
  • pBAD_IFP2.0.gb
• A portion of this plasmid was derived from a plasmid made by: pBAD vector was cloned from Addgene #54762 IFP2.0 insert was cloned from Addgene #54785

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry