Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p8115 LentiCRISPR v2 sgPTPN14-3
(Plasmid #163314)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 163314 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    LentiCRISPR v2
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgPTPN14-3
  • gRNA/shRNA sequence
    CCACACTGGACGTGAACGGG
  • Species
    Synthetic
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer Human U6.F
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p8115 LentiCRISPR v2 sgPTPN14-3 was a gift from Elizabeth White (Addgene plasmid # 163314 ; http://n2t.net/addgene:163314 ; RRID:Addgene_163314)
  • For your References section:

    PTPN14 degradation by high-risk human papillomavirus E7 limits keratinocyte differentiation and contributes to HPV-mediated oncogenesis. Hatterschide J, Bohidar AE, Grace M, Nulton TJ, Kim HW, Windle B, Morgan IM, Munger K, White EA. Proc Natl Acad Sci U S A. 2019 Apr 2;116(14):7033-7042. doi: 10.1073/pnas.1819534116. Epub 2019 Mar 20. 10.1073/pnas.1819534116 PubMed 30894485