p8116 LentiCRISPR v2 sgPTPN14-4
(Plasmid
#163316)
-
PurposeExpresses Cas9 and a human PTPN14-targeting control guide RNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163316 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLentiCRISPR v2
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgPTPN14-4
-
gRNA/shRNA sequenceTGTGCTTACCGTGTGAAAGA
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer Human U6.F
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p8116 LentiCRISPR v2 sgPTPN14-4 was a gift from Elizabeth White (Addgene plasmid # 163316 ; http://n2t.net/addgene:163316 ; RRID:Addgene_163316) -
For your References section:
A Conserved Amino Acid in the C Terminus of Human Papillomavirus E7 Mediates Binding to PTPN14 and Repression of Epithelial Differentiation. Hatterschide J, Brantly AC, Grace M, Munger K, White EA. J Virol. 2020 Aug 17;94(17). pii: JVI.01024-20. doi: 10.1128/JVI.01024-20. Print 2020 Aug 17. 10.1128/JVI.01024-20 PubMed 32581101