Bmpr2 gRNA#2
(Plasmid
#163389)
-
PurposeCas9-mediated knockout of Bmpr2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163389 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonegRNA backbone
- Backbone size w/o insert (bp) 2763
- Total vector size (bp) 2812
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBmpr2
-
gRNA/shRNA sequenceTCCAAAGGGAGCACGTGTTATGG
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_007561.4
-
Entrez GeneBmpr2 (a.k.a. 2610024H22Rik, BMP-2, BMPR-2, BMPR-II, BMPRII, BRK-3, Gm20272)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Bmpr2 gRNA#2 was a gift from Takeshi Imai (Addgene plasmid # 163389 ; http://n2t.net/addgene:163389 ; RRID:Addgene_163389) -
For your References section:
BMPR-2 gates activity-dependent stabilization of primary dendrites during mitral cell remodeling. Aihara S, Fujimoto S, Sakaguchi R, Imai T. Cell Rep. 2021 Jun 22;35(12):109276. doi: 10.1016/j.celrep.2021.109276. 10.1016/j.celrep.2021.109276 PubMed 34161760