Skip to main content

AiP995-pAAV-mscRE10-minBGpromoter-EGFP-WPRE-hGHpA
(Plasmid #163485)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163485 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-mscRE4-minBGpromoter-EGFP-WPRE-hGHpA
  • Backbone manufacturer
    Allen Institute
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Species
    Synthetic
  • Insert Size (bp)
    720
  • Promoter Beta Globin minimal promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Mlul (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer CACCACCTGTCAGCTCCTTT
  • 3′ sequencing primer AAGGGAGATCCGACTCGTCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Funded by BRAIN initiative.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AiP995-pAAV-mscRE10-minBGpromoter-EGFP-WPRE-hGHpA was a gift from Allen Institute for Brain Science & Bosiljka Tasic (Addgene plasmid # 163485 ; http://n2t.net/addgene:163485 ; RRID:Addgene_163485)
  • For your References section:

    Enhancer viruses for combinatorial cell-subclass-specific labeling. Graybuck LT, Daigle TL, Sedeno-Cortes AE, Walker M, Kalmbach B, Lenz GH, Morin E, Nguyen TN, Garren E, Bendrick JL, Kim TK, Zhou T, Mortrud M, Yao S, Siverts LA, Larsen R, Gore BB, Szelenyi ER, Trader C, Balaram P, van Velthoven CTJ, Chiang M, Mich JK, Dee N, Goldy J, Cetin AH, Smith K, Way SW, Esposito L, Yao Z, Gradinaru V, Sunkin SM, Lein E, Levi BP, Ting JT, Zeng H, Tasic B. Neuron. 2021 Mar 23. pii: S0896-6273(21)00159-8. doi: 10.1016/j.neuron.2021.03.011. 10.1016/j.neuron.2021.03.011 PubMed 33789083