Dcp2 300
(Plasmid
#163577)
-
Purposeexpress Dcp2 300 at endogenous level in S.cerevisiae
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRP1903
- Backbone size w/o insert (bp) 5827
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDcp2
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1428
-
MutationTruncation of C-terminal domian (301-970)
-
Entrez GeneDCP2 (a.k.a. YNL118C, PSU1)
- Promoter DCP2 promoter
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer See comments
- 3′ sequencing primer Dcp2-seq3: CCACATTGATAAGGGTCTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lacking C-terminal domain.
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Dcp2 300 was a gift from Roy Parker (Addgene plasmid # 163577 ; http://n2t.net/addgene:163577 ; RRID:Addgene_163577) -
For your References section:
A quantitative inventory of yeast P body proteins reveals principles of composition and specificity. Xing W, Muhlrad D, Parker R, Rosen MK. Elife. 2020 Jun 19;9. pii: 56525. doi: 10.7554/eLife.56525. 10.7554/eLife.56525 PubMed 32553117