Skip to main content

Dcp2 300 AAAA
(Plasmid #163579)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163579 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRP1903
  • Backbone size w/o insert (bp) 5827
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Dcp2
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1428
  • Mutation
    Truncation of C-terminal domain (301-970); mutations: R170A K212A K216A R229A
  • Entrez Gene
    DCP2 (a.k.a. YNL118C, PSU1)
  • Promoter DCP2 promoter
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer See comments
  • 3′ sequencing primer Dcp2-seq3: CCACATTGATAAGGGTCTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    received from Roy Parker's lab at University of Colorado, Boulder

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

impaired RNA binding. 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Dcp2 300 AAAA was a gift from Michael Rosen (Addgene plasmid # 163579 ; http://n2t.net/addgene:163579 ; RRID:Addgene_163579)
  • For your References section:

    A quantitative inventory of yeast P body proteins reveals principles of composition and specificity. Xing W, Muhlrad D, Parker R, Rosen MK. Elife. 2020 Jun 19;9. pii: 56525. doi: 10.7554/eLife.56525. 10.7554/eLife.56525 PubMed 32553117