Dcp2 ΔH1 Δ5H
(Plasmid
#163582)
-
Purposeexpress Dcp2 ΔH1 Δ5H at endogenous level in S.cerevisiae
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163582 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRP1903
- Backbone size w/o insert (bp) 5827
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDcp2
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)3438
-
MutationL255A; mutate 440-450, 489-500, 701-708, 827-831, and 935-938 to all alanines
-
Entrez GeneDCP2 (a.k.a. YNL118C, PSU1)
- Promoter DCP2 promoter
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer See comments
- 3′ sequencing primer Dcp2-seq3: CCACATTGATAAGGGTCTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRoy Parker's lab at University of Colorado, Boulder
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Impaired Edc3 binding sites (first HLM, and 5 additional HLMs in C-terminal domain).
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Dcp2 ΔH1 Δ5H was a gift from Michael Rosen (Addgene plasmid # 163582 ; http://n2t.net/addgene:163582 ; RRID:Addgene_163582) -
For your References section:
A quantitative inventory of yeast P body proteins reveals principles of composition and specificity. Xing W, Muhlrad D, Parker R, Rosen MK. Elife. 2020 Jun 19;9. pii: 56525. doi: 10.7554/eLife.56525. 10.7554/eLife.56525 PubMed 32553117