Skip to main content

pAWK61
(Plasmid #163642)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163642 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAP088
  • Backbone manufacturer
    Bob Goldstein/Ari Pani
  • Backbone size w/o insert (bp) 11401
  • Total vector size (bp) 15756
  • Vector type
    Worm Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DHB::GFP-P2A-H2B::2xmKate2::3xHA
  • Alt name
    DNA Helicase B (CDK sensor)
  • Alt name
    his-58 (H2B)
  • Species
    H. sapiens (human), C. elegans (nematode)
  • Insert Size (bp)
    3498
  • Entrez Gene
    his-58 (a.k.a. CELE_F54E12.4)
  • Promoter rps-27
  • Tags / Fusion Proteins
    • GFP (C terminal on insert)
    • 2xmKate2 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgtaaaacgacggccagt
  • 3′ sequencing primer CAGGAAACAGCTATGACCATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

GFP fusion of C. elegans codon-optimized DNA Helicase B (DHB) under the rps-27 promoter for ubiquitous expression, co-expressed with H2B::2xmKate2. Plasmid is for CRISPR/Cas9-mediated single copy insertion at the ttTi4348 site on Chromosome I and can be paired with sgRNA plasmid pAP082

Please note: Plasmid contains a 117bp deletion in left homology arm relative to the depositor's provided sequence. This deletion is not known to affect plasmid function, but may slightly lower knock-in efficiency.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAWK61 was a gift from David Matus (Addgene plasmid # 163642 ; http://n2t.net/addgene:163642 ; RRID:Addgene_163642)
  • For your References section:

    Visualizing the metazoan proliferation-quiescence decision in vivo. Adikes RC, Kohrman AQ, Martinez MAQ, Palmisano NJ, Smith JJ, Medwig-Kinney TN, Min M, Sallee MD, Ahmed OB, Kim N, Liu S, Morabito RD, Weeks N, Zhao Q, Zhang W, Feldman JL, Barkoulas M, Pani AM, Spencer SL, Martin BL, Matus DQ. Elife. 2020 Dec 22;9. pii: 63265. doi: 10.7554/eLife.63265. 10.7554/eLife.63265 PubMed 33350383