pTBL1269 pLenti-CHYRON17-pEF1a(short)-Luc2-P2A-tdTomato-T2A-TdT
(Plasmid
#163643)
-
PurposeMakes a lentivirus that expresses hgRNA with 17nt spacer and Luc2, tdTomato, and human TdT.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163643 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelenti, 3rd generation
-
Backbone manufacturerPhil Sharp and Feng Zhang, Addgene Plasmid #63592
- Backbone size w/o insert (bp) 8251
- Total vector size (bp) 13228
-
Modifications to backboneAdded a pU6-hgRNA expression cassette and pEFS-Luc2-P2A-tdTomato-T2A-human TdT
-
Vector typeLentiviral
-
Selectable markerstdTomato
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsCells can be grown at 37C, but growth at 30C is recommended for NEBStable.
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namepU6-CHYRON17 hgRNA
-
SpeciesSynthetic
-
Insert Size (bp)349
-
MutationThe SpCas9 sgRNA constant region is mutated to make it self-targeting.
- Promoter pU6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AAGTAAGACCACCGCACAGC
- 3′ sequencing primer TGCTGTCCCTGTAATAAACC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameLuc2-P2A-tdTomato-T2A-human TdT
-
Alt nameterminal deoxynucleotidyl transferase
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4752
-
Entrez GeneDNTT (a.k.a. TDT)
- Promoter EFS
-
Tag
/ Fusion Protein
- Luc2-P2A-tdTomato-T2A (N terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer AAAGTGATGTCGTGTACTGG
- 3′ sequencing primer AGCAGCGTATCCACATAGCG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypU6 is from pSQT1313, Addgene Plasmid #53370, made by the Keith Joung lab. The Luc2-P2A-tdTomato sequence is from pCDH-EF1-Luc2-P2A-tdTomato, Addgene Plasmid #72486, made by the Kazuhiro Oka lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The mutations that make the sgRNA scaffold self-targeting or homing are described in Perli et al., 2016, doi: 10.1126/science.aag0511 and Kalhor et al., 2017, doi: 10.1038/nmeth.4108.
This is a 3rd generation lentiviral transfer plasmid. Please visit https://doi.org/10.1101/639120 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTBL1269 pLenti-CHYRON17-pEF1a(short)-Luc2-P2A-tdTomato-T2A-TdT was a gift from Chang Liu (Addgene plasmid # 163643 ; http://n2t.net/addgene:163643 ; RRID:Addgene_163643) -
For your References section:
Lineage tracing and analog recording in mammalian cells by single-site DNA writing. Loveless TB, Grotts JH, Schechter MW, Forouzmand E, Carlson CK, Agahi BS, Liang G, Ficht M, Liu B, Xie X, Liu CC. Nat Chem Biol. 2021 Jun;17(6):739-747. doi: 10.1038/s41589-021-00769-8. Epub 2021 Mar 22. 10.1038/s41589-021-00769-8 PubMed 33753928