Skip to main content
Addgene

pTBL1401 pLenti-pEF1a(short)-mNeonGreen-P2A-Cas9
(Plasmid #163644)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163644 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lenti, 3rd generation
  • Backbone manufacturer
    Phil Sharp and Feng Zhang, Addgene Plasmid #63592
  • Backbone size w/o insert (bp) 8251
  • Total vector size (bp) 13264
  • Modifications to backbone
    Switched the order of the fluorescent protein and Cas9, and replaced EGFP with mNeonGreen. Also removed an EcoRI site 3' of Cas9.
  • Vector type
    Lentiviral
  • Selectable markers
    mNeonGreen

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Cells can be grown at 37C, but growth at 30C is recommended for NEBStable.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mNeonGreen-P2A-Cas9
  • Species
    Synthetic
  • Promoter EFS
  • Tag / Fusion Protein
    • mNeonGreen-P2A (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAAAGTGATGTCGTGTACTGG
  • 3′ sequencing primer GAGGTTGATTACCGATAAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    mNeonGreen was cloned from pmNeonGreenHO-G, Addgene Plasmid #127912, made by the lab of Isei Tanida.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This is a 3rd generation lentiviral transfer plasmid. Please visit https://doi.org/10.1101/639120 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTBL1401 pLenti-pEF1a(short)-mNeonGreen-P2A-Cas9 was a gift from Chang Liu (Addgene plasmid # 163644 ; http://n2t.net/addgene:163644 ; RRID:Addgene_163644)
  • For your References section:

    Lineage tracing and analog recording in mammalian cells by single-site DNA writing. Loveless TB, Grotts JH, Schechter MW, Forouzmand E, Carlson CK, Agahi BS, Liang G, Ficht M, Liu B, Xie X, Liu CC. Nat Chem Biol. 2021 Jun;17(6):739-747. doi: 10.1038/s41589-021-00769-8. Epub 2021 Mar 22. 10.1038/s41589-021-00769-8 PubMed 33753928