Skip to main content

pAAV-CAG-GFP-mirMecp2
(Plasmid #163704)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163704 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mirMecp2 and EGFP
  • gRNA/shRNA sequence
    TGCTGTTCACCTGAACACCTTCTGATGTTTTGGCCACTGACTGACATCAGAAGGTTCAGGTGAA
  • Species
    M. musculus (mouse); Aequorea victoria
  • Entrez Gene
    Mecp2 (a.k.a. 1500041B07Rik, D630021H01Rik, Mbd5, WBP10)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer EGFP-C
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-GFP-mirMecp2 was a gift from Michisuke Yuzaki (Addgene plasmid # 163704 ; http://n2t.net/addgene:163704 ; RRID:Addgene_163704)
  • For your References section:

    MeCP2 Levels Regulate the 3D Structure of Heterochromatic Foci in Mouse Neurons. Ito-Ishida A, Baker SA, Sillitoe RV, Sun Y, Zhou J, Ono Y, Iwakiri J, Yuzaki M, Zoghbi HY. J Neurosci. 2020 Nov 4;40(45):8746-8766. doi: 10.1523/JNEUROSCI.1281-19.2020. Epub 2020 Oct 12. 10.1523/JNEUROSCI.1281-19.2020 PubMed 33046553