gRNA_CloningVector_miRFP670
(Plasmid
#163748)
-
Purpose(Empty Backbone) Empty gRNA cloning vector, contains a miRFP670 fluorescent marker for FACS sorting after transfection.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163748 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonegRNA_Cloning Vector
- Backbone size (bp) 5238
-
Modifications to backboneInserted CMV-miRFP670 expression cassette into the BsphI cutsite.
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggtggcacttttcggggaa
- 3′ sequencing primer tgacgctcagtggaacgaaa (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA_Cloning Vector (Addgene Plasmid #41824) was modified to insert a CMV-miRFP670 expression cassette (cloned from Addgene Plasmid #79987) into the BsphI cutsite in order to express a fluorescent marker (642nm/670nm) for FACS sorting after mammalian cell transfection.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gRNA_CloningVector_miRFP670 was a gift from Jennifer Mitchell (Addgene plasmid # 163748 ; http://n2t.net/addgene:163748 ; RRID:Addgene_163748) -
For your References section:
Epigenetic reprogramming of a distal developmental enhancer cluster drives SOX2 overexpression in breast and lung adenocarcinoma. Abatti LE, Lado-Fernandez P, Huynh L, Collado M, Hoffman MM, Mitchell JA. Nucleic Acids Res. 2023 Sep 22:gkad734. doi: 10.1093/nar/gkad734. 10.1093/nar/gkad734 PubMed 37738673