Skip to main content

gRNA_CloningVector_miRFP670
(Plasmid #163748)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163748 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    gRNA_Cloning Vector
  • Backbone size (bp) 5238
  • Modifications to backbone
    Inserted CMV-miRFP670 expression cassette into the BsphI cutsite.
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggtggcacttttcggggaa
  • 3′ sequencing primer tgacgctcagtggaacgaaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA_Cloning Vector (Addgene Plasmid #41824) was modified to insert a CMV-miRFP670 expression cassette (cloned from Addgene Plasmid #79987) into the BsphI cutsite in order to express a fluorescent marker (642nm/670nm) for FACS sorting after mammalian cell transfection.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gRNA_CloningVector_miRFP670 was a gift from Jennifer Mitchell (Addgene plasmid # 163748 ; http://n2t.net/addgene:163748 ; RRID:Addgene_163748)
  • For your References section:

    Epigenetic reprogramming of a distal developmental enhancer cluster drives SOX2 overexpression in breast and lung adenocarcinoma. Abatti LE, Lado-Fernandez P, Huynh L, Collado M, Hoffman MM, Mitchell JA. Nucleic Acids Res. 2023 Sep 22:gkad734. doi: 10.1093/nar/gkad734. 10.1093/nar/gkad734 PubMed 37738673