pAC8_PH-6His-Nter-GWs-Lox (VE5587)
(Plasmid
#163768)
-
PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter 6 His tag under the pH promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163768 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAcPAK8
-
Backbone manufacturerClontech
-
Modifications to backboneThe pAC8_PH-6His-Nter-GWs-Lox (VE5587) is a derivative of pBAcPAK8 (Clontech) for generation of recombinant baculoviruses by homologous recombination. It contains an expression cassette composed of one baculovirus late promoter (PH). This vector bears a 6 His sequence allowing the expression of a N-terminally-tagged protein under the control of the pH promoter. Insertion of DNA sequence is typically performed by Gateway® LR reaction.
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameN-terminal 6His tag
- Promoter PH
-
Tag
/ Fusion Protein
- 6 His Tag (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ACCATCTCGCAAATAAATAA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC8_PH-6His-Nter-GWs-Lox (VE5587) was a gift from Arnaud Poterszman (Addgene plasmid # 163768 ; http://n2t.net/addgene:163768 ; RRID:Addgene_163768) -
For your References section:
HR-Bac, a toolbox based on homologous recombination for expression, screening and production of multiprotein complexes using the baculovirus expression system. Kolesnikova O, Zachayus A, Pichard S, Osz J, Rochel N, Rossolillo P, Kolb-Cheynel I, Troffer-Charlier N, Compe E, Bensaude O, Berger I, Poterszman A. Sci Rep. 2022 Feb 7;12(1):2030. doi: 10.1038/s41598-021-04715-5. 10.1038/s41598-021-04715-5 PubMed 35132103