Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

mWasabi-ADAP1
(Plasmid #163906)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 163906 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFastBac HTb
  • Backbone manufacturer
    thermo fisher (Invitrogen)
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 6672
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ADAP1
  • Alt name
    Centaurin alpha 1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1854
  • Entrez Gene
    Adap1 (a.k.a. 4930431P11Rik, Cent, Centa1, GC1L, p42IP4)
  • Promoter polyhedrin
  • Tag / Fusion Protein
    • mWasabi fluorescent tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NCO1 (not destroyed)
  • 3′ cloning site NOT1 (not destroyed)
  • 5′ sequencing primer AAATGATAACCATCTCGC
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    synthetic DNA was codon optimized produced by a company (genscript)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mWasabi-ADAP1 was a gift from Martin Loose (Addgene plasmid # 163906 ; http://n2t.net/addgene:163906 ; RRID:Addgene_163906)
  • For your References section:

    In vitro reconstitution reveals phosphoinositides as cargo-release factors and activators of the ARF6 GAP ADAP1. Duellberg C, Auer A, Canigova N, Loibl K, Loose M. Proc Natl Acad Sci U S A. 2021 Jan 5;118(1). pii: 2010054118. doi: 10.1073/pnas.2010054118. Epub 2020 Dec 18. 10.1073/pnas.2010054118 PubMed 33443153