Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRSF-ChPylTMSK
(Plasmid #163915)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 163915 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRSF
  • Backbone size w/o insert (bp) 2507
  • Total vector size (bp) 3767
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tRNA synthetase
  • Alt name
    ChPylTMSK
  • Species
    Synthetic
  • Insert Size (bp)
    1260
  • Promoter T7

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTCACATGTTGCGAAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSF-ChPylTMSK was a gift from Thomas Huber (Addgene plasmid # 163915 ; http://n2t.net/addgene:163915 ; RRID:Addgene_163915)
  • For your References section:

    Genetic Encoding of N(6)-(((Trimethylsilyl)methoxy)carbonyl)-l-lysine for NMR Studies of Protein-Protein and Protein-Ligand Interactions. Abdelkader EH, Qianzhu H, Tan YJ, Adams LA, Huber T, Otting G. J Am Chem Soc. 2021 Jan 5. doi: 10.1021/jacs.0c11971. 10.1021/jacs.0c11971 PubMed 33399460