pET-PhoCl1-6His
(Plasmid
#164033)
-
PurposeExpressed PhoCl1 in a pET expression vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164033 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-28a(+)
- Backbone size w/o insert (bp) 5248
- Total vector size (bp) 5974
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePhoCl1
-
SpeciesSynthetic
-
Insert Size (bp)726
- Promoter T7 promotor
-
Tag
/ Fusion Protein
- 6xHis Tag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ggaattgtgagcggataacaattcc
- 3′ sequencing primer ccgctgagcaataactagc
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.12.10.419556v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-PhoCl1-6His was a gift from Robert Campbell (Addgene plasmid # 164033 ; http://n2t.net/addgene:164033 ; RRID:Addgene_164033) -
For your References section:
Photocleavable proteins that undergo fast and efficient dissociation. Lu X, Wen Y, Zhang S, Zhang W, Chen Y, Shen Y, Lemieux MJ, Campbell RE. Chem Sci. 2021 May 31;12(28):9658-9672. doi: 10.1039/d1sc01059j. eCollection 2021 Jul 21. 10.1039/d1sc01059j PubMed 34349937