BC1364-mouse U6-sgH2B
(Plasmid
#164043)
-
PurposeU6-driven sgRNA targeting H2B
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164043 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC19
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B targeting sgRNA
-
gRNA/shRNA sequenceGCGAGCGCCAGGTCCCGGCA
-
SpeciesH. sapiens (human), Synthetic
- Promoter mouse U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BC1364-mouse U6-sgH2B was a gift from Baohui Chen (Addgene plasmid # 164043 ; http://n2t.net/addgene:164043 ; RRID:Addgene_164043) -
For your References section:
Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag. Chen B, Zou W, Xu H, Liang Y, Huang B. Nat Commun. 2018 Nov 29;9(1):5065. doi: 10.1038/s41467-018-07498-y. 10.1038/s41467-018-07498-y PubMed 30498221