Skip to main content

PHY55-mouse U6-sgLMNA
(Plasmid #164045)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164045 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LMNA targeting sgRNA
  • gRNA/shRNA sequence
    GCCATGGAGACCCCGTCCCAG
  • Species
    H. sapiens (human), Synthetic
  • Promoter mouse U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PHY55-mouse U6-sgLMNA was a gift from Baohui Chen (Addgene plasmid # 164045 ; http://n2t.net/addgene:164045 ; RRID:Addgene_164045)
  • For your References section:

    TriTag: an integrative tool to correlate chromatin dynamics and gene expression in living cells. Xu H, Wang J, Liang Y, Fu Y, Li S, Huang J, Xu H, Zou W, Chen B. Nucleic Acids Res. 2020 Oct 26. pii: 5940501. doi: 10.1093/nar/gkaa906. 10.1093/nar/gkaa906 PubMed 33104788