human KANK2 Ankyrin Repeats pET151
(Plasmid
#164054)
-
PurposeExpresses human KANK2 Ank domain in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET151
- Backbone size w/o insert (bp) 5760
- Total vector size (bp) 6510
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKidney Ankyrin Repeat-Containing Protein 2
-
Alt nameKANK 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)750
-
Entrez GeneKANK2 (a.k.a. ANKRD25, MXRA3, NPHS16, PPKWH, SIP)
- Promoter T7
-
Tag
/ Fusion Protein
- His-tag, TEV cleavage site (N terminal on backbone)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
human KANK2 Ankyrin Repeats pET151 was a gift from Ben Goult (Addgene plasmid # 164054 ; http://n2t.net/addgene:164054 ; RRID:Addgene_164054)