EF1a_DIO_R106W-HaloTag
(Plasmid
#164063)
-
PurposeDouble-Floxed Inverted Open reading frame for mouseMeCP2(alpha) carrying R106W mutation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164063 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-EF1a
- Total vector size (bp) 8063
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMeCP2 R106W
-
Alt nameMecp2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2400
-
Entrez GeneMecp2 (a.k.a. 1500041B07Rik, D630021H01Rik, Mbd5, WBP10)
- Promoter EF1A
-
Tag
/ Fusion Protein
- HaloTag (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTGGATTGTAGCTGCTATTAGCAATATGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EF1a_DIO_R106W-HaloTag was a gift from Nathaniel Heintz (Addgene plasmid # 164063 ; http://n2t.net/addgene:164063 ; RRID:Addgene_164063) -
For your References section:
MeCP2 nuclear dynamics in live neurons results from low and high affinity chromatin interactions. Piccolo FM, Liu Z, Dong P, Hsu CL, Stoyanova EI, Rao A, Tjian R, Heintz N. Elife. 2019 Dec 23;8. pii: 51449. doi: 10.7554/eLife.51449. 10.7554/eLife.51449 PubMed 31868585