pEF-XMAS-2xStop
(Plasmid
#164412)
-
PurposeTransient Reporter for Editing Enrichment (TREE) Plasmid. GFP turns on with adenosine base editing (ABE). 2 stop codons.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164412 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneBackbone derived from pEF-GFP (Addgene #11154)
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
Alt nameRFP
- Promoter EF1-alpha
-
Tag
/ Fusion Protein
- T2A-GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer TAGTCGCCGTGAACGTTCTTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF-XMAS-2xStop was a gift from Xiao Wang (Addgene plasmid # 164412 ; http://n2t.net/addgene:164412 ; RRID:Addgene_164412) -
For your References section:
A Cas9-mediated adenosine transient reporter enables enrichment of ABE-targeted cells. Brookhouser N, Nguyen T, Tekel SJ, Standage-Beier K, Wang X, Brafman DA. BMC Biol. 2020 Dec 14;18(1):193. doi: 10.1186/s12915-020-00929-7. 10.1186/s12915-020-00929-7 PubMed 33317513