Skip to main content

AdTrack-HNF4
(Plasmid #16445)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 16445 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAdTrack-CMV
  • Backbone size w/o insert (bp) 9000
  • Vector type
    Mammalian Expression, Adenoviral
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HNF4
  • Alt name
    HNF-4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1400
  • Entrez Gene
    Hnf4a (a.k.a. HNF-4, Hnf4, Hnf4alpha, MODY1, Nr2a1, TCF-14, Tcf14)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' PCR primer: TTAAGGTACCACCATGGATATGGCCGACTACA GCGCTGCCC. 3' PCR primer: TTAAAAGCTTCTAGATGGCTTCTTGCTTGGTG ATCGTTGGC. Full sequence is approximated based on primers and predicted AdTrack sequence.

Recombine with pAdEasy to create adenovirus.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AdTrack-HNF4 was a gift from Bruce Spiegelman (Addgene plasmid # 16445)
  • For your References section:

    Partnership of PGC-1alpha and HNF4alpha in the regulation of lipoprotein metabolism. Rhee J, Ge H, Yang W, Fan M, Handschin C, Cooper M, Lin J, Li C, Spiegelman BM. J Biol Chem. 2006 May 26. 281(21):14683-90. 10.1074/jbc.M512636200 PubMed 16574644