pSP64T-ythdf2-3xflag
(Plasmid
#164489)
-
PurposeExpresses zebrafish ythdf2 with 3x flag tag, for mRNA injection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164489 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSP64T
-
Vector typeProduction of mRNA for zebrafish injection.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameythdf2
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1840
-
Entrez Geneythdf2 (a.k.a. yth2, zgc:56224)
- Promoter SP6
-
Tag
/ Fusion Protein
- 3x-flagtag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ACGCTCAACTTTGGCAGATCCG
- 3′ sequencing primer GGAGCAGATACGAATGGCTACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSP64T-ythdf2-3xflag was a gift from Antonio Giraldez (Addgene plasmid # 164489 ; http://n2t.net/addgene:164489 ; RRID:Addgene_164489) -
For your References section:
Ythdf m(6)A Readers Function Redundantly during Zebrafish Development. Kontur C, Jeong M, Cifuentes D, Giraldez AJ. Cell Rep. 2020 Dec 29;33(13):108598. doi: 10.1016/j.celrep.2020.108598. 10.1016/j.celrep.2020.108598 PubMed 33378672