pXPR_219
(Plasmid
#164559)
-
PurposeLentiviral vector that encodes two sgRNA expression cassettes. Also encodes the fluorophore violet-excited GFP (Vex) as a marker of transduction.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164559 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepXPR_053
-
Backbone manufacturerArlene Sharpe's Lab
- Backbone size w/o insert (bp) 7670
- Total vector size (bp) 9993
-
Modifications to backbone(1) Removal of LacO sequence from human U6 promoter. (2) Usage of tracrRNA V4 following sgRNA transcribed by human U6 promoter. (3) Addition of second sgRNA cassette containing mouse U6 promoter driving transcription of an sgRNA followed by tracrRNA V1. This cassette contains cloning sites for BfuAI as well as a stuffer to enable efficient cloning via BfuAI. (4) Codon optimization of Vex fluorophore for murine systems.
-
Vector typeMammalian Expression, Lentiviral, CRISPR ; Dual sgRNA
-
Selectable markersVex fluorescent reporter
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameFirst sgRNA cassette
- Promoter Human U6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer TGCAAATTAACCGGGGCAGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSecond sgRNA cassette
- Promoter Mouse U6
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BfuAI (destroyed during cloning)
- 3′ cloning site BfuAI (destroyed during cloning)
- 5′ sequencing primer CCCTGCCCCGGTTAATTTGC
- 3′ sequencing primer TCTACTATTCTTTCCCCTGCACTGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXPR_219 was a gift from Arlene Sharpe (Addgene plasmid # 164559 ; http://n2t.net/addgene:164559 ; RRID:Addgene_164559) -
For your References section:
X-CHIME enables combinatorial, inducible, lineage-specific and sequential knockout of genes in the immune system. LaFleur MW, Lemmen AM, Streeter ISL, Nguyen TH, Milling LE, Derosia NM, Hoffman ZM, Gillis JE, Tjokrosurjo Q, Markson SC, Huang AY, Anekal PV, Montero Llopis P, Haining WN, Doench JG, Sharpe AH. Nat Immunol. 2023 Nov 27. doi: 10.1038/s41590-023-01689-6. 10.1038/s41590-023-01689-6 PubMed 38012416
Map uploaded by the depositor.
