Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pXPR_220
(Plasmid #164560)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 164560 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pXPR_053
  • Backbone manufacturer
    Arlene Sharpe's Lab
  • Backbone size w/o insert (bp) 7670
  • Total vector size (bp) 10369
  • Modifications to backbone
    (1) Removal of LacO sequence from human U6 promoter. (2) Usage of the Broad GPP chRNA V2 following the sgRNA transcribed by human U6 promoter. (3) Introduction of a stuffer into the stem loop of the Broad GPP chRNA V2. The stuffer contains transcriptional stops on the proximal 5’ and 3’ ends. This stuffer is flanked by FRT sequences that are in the same directional orientation. (4) Addition of second sgRNA cassette containing mouse U6 promoter driving transcription of an sgRNA followed by tracrRNA V1. This cassette contains cloning sites for BfuAI as well as a stuffer to enable efficient cloning via BfuAI. (5) Codon optimization of Vex fluorophore for murine systems.
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR ; Flp/FRT
  • Selectable markers
    Vex fluorescent reporter

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    First sgRNA cassette
  • Promoter Human U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer TGCAAATTAACCGGGGCAGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Second sgRNA cassette
  • Promoter Mouse U6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BfuAI (destroyed during cloning)
  • 3′ cloning site BfuAI (destroyed during cloning)
  • 5′ sequencing primer CCCTGCCCCGGTTAATTTGC
  • 3′ sequencing primer TCTACTATTCTTTCCCCTGCACTGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXPR_220 was a gift from Arlene Sharpe (Addgene plasmid # 164560 ; http://n2t.net/addgene:164560 ; RRID:Addgene_164560)
  • For your References section:

    X-CHIME enables combinatorial, inducible, lineage-specific and sequential knockout of genes in the immune system. LaFleur MW, Lemmen AM, Streeter ISL, Nguyen TH, Milling LE, Derosia NM, Hoffman ZM, Gillis JE, Tjokrosurjo Q, Markson SC, Huang AY, Anekal PV, Montero Llopis P, Haining WN, Doench JG, Sharpe AH. Nat Immunol. 2023 Nov 27. doi: 10.1038/s41590-023-01689-6. 10.1038/s41590-023-01689-6 PubMed 38012416