Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET28-sfGFP[N150TAA]
(Plasmid #164581)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 164581 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET28
  • Backbone size w/o insert (bp) 5205
  • Total vector size (bp) 5952
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sfGFP-150TAA
  • Insert Size (bp)
    747
  • Mutation
    N150TAA Mutation
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Production of full-length protein requires TAA suppression machinery.

Please visit https://doi.org/10.1101/2021.04.12.439361 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28-sfGFP[N150TAA] was a gift from Ryan Mehl (Addgene plasmid # 164581 ; http://n2t.net/addgene:164581 ; RRID:Addgene_164581)
  • For your References section:

    Genetic Incorporation of Two Mutually Orthogonal Bioorthogonal Amino Acids That Enable Efficient Protein Dual-Labeling in Cells. Bednar RM, Jana S, Kuppa S, Franklin R, Beckman J, Antony E, Cooley RB, Mehl RA. ACS Chem Biol. 2021 Nov 19;16(11):2612-2622. doi: 10.1021/acschembio.1c00649. Epub 2021 Sep 30. 10.1021/acschembio.1c00649 PubMed 34590824