Skip to main content

GFP-RAB35
(Plasmid #164630)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164630 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDEST53
  • Backbone size w/o insert (bp) 7767
  • Total vector size (bp) 6766
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RAB35
  • Alt name
    Ras-related protein Rab-35
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    606
  • Mutation
    none
  • GenBank ID
    NM_006861.7 NM_006861.7
  • Entrez Gene
    RAB35 (a.k.a. H-ray, RAB1C, RAY)
  • Promoter CMV
  • Tag / Fusion Protein
    • cycle 3 GFP (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer atggcccgggactacgaccacc
  • 3′ sequencing primer ttagcagcagcgtt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-RAB35 was a gift from Mark Cookson (Addgene plasmid # 164630 ; http://n2t.net/addgene:164630 ; RRID:Addgene_164630)
  • For your References section:

    LRRK2 mediates tubulation and vesicle sorting from lysosomes. Bonet-Ponce L, Beilina A, Williamson CD, Lindberg E, Kluss JH, Saez-Atienzar S, Landeck N, Kumaran R, Mamais A, Bleck CKE, Li Y, Cookson MR. Sci Adv. 2020 Nov 11;6(46). pii: 6/46/eabb2454. doi: 10.1126/sciadv.abb2454. Print 2020 Nov. 10.1126/sciadv.abb2454 PubMed 33177079