Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

2xmyc-JIP4
(Plasmid #164633)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164633 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV-Tag3B-2xMYC
  • Backbone size w/o insert (bp) 6095
  • Total vector size (bp) 8433
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    JIP4
  • Alt name
    SPAG9
  • Alt name
    C-Jun-amino-terminal kinase-interacting protein 4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3962
  • GenBank ID
    NM_001130528.2 NM_001130528.3
  • Entrez Gene
    SPAG9 (a.k.a. CT89, HLC-6, HLC4, HLC6, JIP-4, JIP4, JLP, PHET, PIG6)
  • Promoter CMV
  • Tag / Fusion Protein
    • 2xmyc (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer atggagctggaggacggtgtggtg
  • 3′ sequencing primer tcactcattgccatacatcacttgcca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    2xmyc-JIP4 was a gift from Mark Cookson (Addgene plasmid # 164633 ; http://n2t.net/addgene:164633 ; RRID:Addgene_164633)
  • For your References section:

    LRRK2 mediates tubulation and vesicle sorting from lysosomes. Bonet-Ponce L, Beilina A, Williamson CD, Lindberg E, Kluss JH, Saez-Atienzar S, Landeck N, Kumaran R, Mamais A, Bleck CKE, Li Y, Cookson MR. Sci Adv. 2020 Nov 11;6(46). pii: 6/46/eabb2454. doi: 10.1126/sciadv.abb2454. Print 2020 Nov. 10.1126/sciadv.abb2454 PubMed 33177079