Skip to main content

lentiGuide-Puro PRMT5-CRISPRi
(Plasmid #164637)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164637 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiGuide-Puro #52963
  • Modifications to backbone
    PRMT5 inhibitor sequence cloned into the BsmbI site
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR ; interference
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Use SapI digest to check for unwanted recombination of lentiviral plasmid. Only amplify in RecA- bacteria (eg. Stbl3).
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    target guide sequence PRMT5 inhibition
  • Alt name
    Protein arginine N-methyltransferase 5
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    25
  • Entrez Gene
    PRMT5 (a.k.a. HRMT1L5, HSL7, IBP72, JBP1, SKB1, SKB1Hs)
  • Promoter U6 and EF1A

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CACCGAGCCGCGTGTCCAGCGGGA
  • 3′ sequencing primer AAACTCCCGCTGGACACGCGGCTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiGuide-Puro PRMT5-CRISPRi was a gift from Günter Schneider (Addgene plasmid # 164637 ; http://n2t.net/addgene:164637 ; RRID:Addgene_164637)