lentiGuide-Puro PRMT5-CRISPRi
              
              
                (Plasmid
                
                #164637)
              
            
            
            
          - 
            PurposelentiGuide-Puro backbone with cloned target sequence for human PRMT5. The insert is: 5´- CACCGAGCCGCGTGTCCAGCGGGA-3. sgRNA achieves a downregulation of PRMT5 in combination with dCAS9-KRAB-MCP2
- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164637 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonelentiGuide-Puro #52963
- 
              Modifications to backbonePRMT5 inhibitor sequence cloned into the BsmbI site
- 
              Vector typeMammalian Expression, Lentiviral, CRISPR ; interference
- 
                Selectable markersPuromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
              Growth instructionsUse SapI digest to check for unwanted recombination of lentiviral plasmid. Only amplify in RecA- bacteria (eg. Stbl3).
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nametarget guide sequence PRMT5 inhibition
- 
                  Alt nameProtein arginine N-methyltransferase 5
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)25
- 
                        Entrez GenePRMT5 (a.k.a. HRMT1L5, HSL7, IBP72, JBP1, SKB1, SKB1Hs)
- Promoter U6 and EF1A
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CACCGAGCCGCGTGTCCAGCGGGA
- 3′ sequencing primer AAACTCCCGCTGGACACGCGGCTC (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: lentiGuide-Puro PRMT5-CRISPRi was a gift from Günter Schneider (Addgene plasmid # 164637 ; http://n2t.net/addgene:164637 ; RRID:Addgene_164637)
