Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #164666)


Item Catalog # Description Quantity Price (USD)
Plasmid 164666 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 3114
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    MIR451A (a.k.a. MIR451, MIRN451, hsa-mir-451, hsa-mir-451a, mir-451a)
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CAATGGGAGTTTGTTTTGGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    MIR1-1 (a.k.a. MIRN1-1, hsa-mir-1-1, miRNA1-1, mir-1-1)
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer TGGGCTATGAACTAATGACC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBI-CMV1-mir451~144-CMV2-mir1 was a gift from David Bartel (Addgene plasmid # 164666 ; ; RRID:Addgene_164666)