Skip to main content

FLAG-PRMT3(E338Q)
(Plasmid #164696)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164696 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PRMT3
  • Alt name
    HRMT1L3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1299
  • Mutation
    E338Q
  • Entrez Gene
    PRMT3 (a.k.a. HRMT1L3)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CMV forward: 5' CGCAAATGGGCGGTAGGCGTG 3'
  • 3′ sequencing primer BGH: 5' TAGAAGGCACAGTCGAGG 3'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FLAG-PRMT3(E338Q) was a gift from Cheryl Arrowsmith (Addgene plasmid # 164696 ; http://n2t.net/addgene:164696 ; RRID:Addgene_164696)
  • For your References section:

    A potent, selective and cell-active allosteric inhibitor of protein arginine methyltransferase 3 (PRMT3). Kaniskan HU, Szewczyk MM, Yu Z, Eram MS, Yang X, Schmidt K, Luo X, Dai M, He F, Zang I, Lin Y, Kennedy S, Li F, Dobrovetsky E, Dong A, Smil D, Min SJ, Landon M, Lin-Jones J, Huang XP, Roth BL, Schapira M, Atadja P, Barsyte-Lovejoy D, Arrowsmith CH, Brown PJ, Zhao K, Jin J, Vedadi M. Angew Chem Int Ed Engl. 2015 Apr 20;54(17):5166-70. doi: 10.1002/anie.201412154. Epub 2015 Feb 27. 10.1002/anie.201412154 PubMed 25728001