FLAG-PRMT3(E338Q)
(Plasmid
#164696)
-
PurposeExpression of PRMT3(E338Q) with an N-terminal FLAG tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164696 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePRMT3
-
Alt nameHRMT1L3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1299
-
MutationE338Q
-
Entrez GenePRMT3 (a.k.a. HRMT1L3)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CMV forward: 5' CGCAAATGGGCGGTAGGCGTG 3'
- 3′ sequencing primer BGH: 5' TAGAAGGCACAGTCGAGG 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FLAG-PRMT3(E338Q) was a gift from Cheryl Arrowsmith (Addgene plasmid # 164696 ; http://n2t.net/addgene:164696 ; RRID:Addgene_164696) -
For your References section:
A potent, selective and cell-active allosteric inhibitor of protein arginine methyltransferase 3 (PRMT3). Kaniskan HU, Szewczyk MM, Yu Z, Eram MS, Yang X, Schmidt K, Luo X, Dai M, He F, Zang I, Lin Y, Kennedy S, Li F, Dobrovetsky E, Dong A, Smil D, Min SJ, Landon M, Lin-Jones J, Huang XP, Roth BL, Schapira M, Atadja P, Barsyte-Lovejoy D, Arrowsmith CH, Brown PJ, Zhao K, Jin J, Vedadi M. Angew Chem Int Ed Engl. 2015 Apr 20;54(17):5166-70. doi: 10.1002/anie.201412154. Epub 2015 Feb 27. 10.1002/anie.201412154 PubMed 25728001