FLAG-PRMT6
(Plasmid
#164697)
-
PurposeExpression of PRMT6 with an N-terminal FLAG tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164697 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePRMT6
-
Alt nameHRMT1L6
-
SpeciesH. sapiens (human)
-
Entrez GenePRMT6 (a.k.a. HRMT1L6)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CMV forward: 5' CGCAAATGGGCGGTAGGCGTG 3'
- 3′ sequencing primer BGH: 5' TAGAAGGCACAGTCGAGG 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FLAG-PRMT6 was a gift from Cheryl Arrowsmith (Addgene plasmid # 164697 ; http://n2t.net/addgene:164697 ; RRID:Addgene_164697) -
For your References section:
A Potent, Selective, and Cell-Active Inhibitor of Human Type I Protein Arginine Methyltransferases. Eram MS, Shen Y, Szewczyk M, Wu H, Senisterra G, Li F, Butler KV, Kaniskan HU, Speed BA, Dela Sena C, Dong A, Zeng H, Schapira M, Brown PJ, Arrowsmith CH, Barsyte-Lovejoy D, Liu J, Vedadi M, Jin J. ACS Chem Biol. 2016 Mar 18;11(3):772-781. doi: 10.1021/acschembio.5b00839. Epub 2015 Dec 8. 10.1021/acschembio.5b00839 PubMed 26598975