pU6-sgRNA EF1Alpha-puro-T2A-BFP.ERH2
(Plasmid
#164801)
-
PurposeFor CRISPRi knockdown of ERH by lentiviral delivery of ERH gRNA2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164801 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepU6-sgRNA EF1Alpha-puro-T2A-BFP
-
Backbone manufacturerJonathan Weissman (Addgene plasmid # 60955)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameERH CRISPRi gRNA2
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BstXI (not destroyed)
- 3′ cloning site BlpI (not destroyed)
- 5′ sequencing primer CGACTCGGTGCCACTTTTTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepuro-T2A-BFP
- Promoter EF1Alpha
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer EF1Alpha sequencing primer (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-sgRNA EF1Alpha-puro-T2A-BFP.ERH2 was a gift from David Bartel (Addgene plasmid # 164801 ; http://n2t.net/addgene:164801 ; RRID:Addgene_164801) -
For your References section:
MicroRNA Clustering Assists Processing of Suboptimal MicroRNA Hairpins through the Action of the ERH Protein. Fang W, Bartel DP. Mol Cell. 2020 Apr 16;78(2):289-302.e6. doi: 10.1016/j.molcel.2020.01.026. 10.1016/j.molcel.2020.01.026 PubMed 32302541