AAV-CAG-SPOTlight-U2GCR
(Plasmid #164819)

• Purpose: Reporter to measure ISR state-dependent protein synthesis
• Depositing Lab: Nicole Calakos
• Publication: Helseth et al Science. 2021 Apr 23;372(6540). pii: 372/6540/eabe1931. doi: 10.1126/science.abe1931.

Backbone

• Vector backbone: AAV
• Backbone size w/o insert (bp): 2959
• Total vector size (bp): 7008
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: SPOTlight-U2GCR
• Alt name: ISR state-dependent protein synthesis reporter
• Insert Size (bp): 2734
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: MfeI (not destroyed)
• 5′ sequencing primer: TCCTTGAAGAAGATGGTGCG
• 3′ sequencing primer: TCACTTGTTCCTAGGACACGG

Resource Information

• Supplemental Documents:
  • AAV-SPOTlight-U2GCR.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the Addgene verified sequence differs from depositor's reference sequence (see Supplemental Documents above). These differences do not affect plasmid function.