Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV-hSyn-DIO-mCReP
(Plasmid #167503)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 167503 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV
  • Backbone size w/o insert (bp) 2773
  • Total vector size (bp) 6788
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Ppp1r15b
  • Alt name
    CReP
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2091
  • GenBank ID
    Ppp1r15b
  • Entrez Gene
    Ppp1r15b (a.k.a. 1810033K10Rik, C530022L24Rik, CReP)
  • Promoter hSyn
  • Tag / Fusion Protein
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer TCGTGTCGTGCCTGAGAGCG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Genscript ORF clone

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-hSyn-DIO-mCReP was a gift from Nicole Calakos (Addgene plasmid # 167503 ; http://n2t.net/addgene:167503 ; RRID:Addgene_167503)
  • For your References section:

    Cholinergic neurons constitutively engage the ISR for dopamine modulation and skill learning in mice. Helseth AR, Hernandez-Martinez R, Hall VL, Oliver ML, Turner BD, Caffall ZF, Rittiner JE, Shipman MK, King CS, Gradinaru V, Gerfen C, Costa-Mattioli M, Calakos N. Science. 2021 Apr 23;372(6540). pii: 372/6540/eabe1931. doi: 10.1126/science.abe1931. 10.1126/science.abe1931 PubMed 33888613